Daredevil Jumps, and Lands on His Feet - New York Times [dayinformations.blogspot.com]
Question by Kuty Puty: How does DNA carry "information"? when textbooks and professors say that DNA carries information, what do they mean? how can a molecule possibly carry actual information? Am i misunderstanding what they mean by information? Please end my confusion =) Best answer for How does DNA carry "information"?:
Answer by offtocollege
Yes. The information is not the kind of information you are thinking of. DNA is a sequence of nucleotide bases that serve to give the sequence for proteins to be created. Sometimes genes can be turned on or off based on environmental factors and different proteins are created in different situations. It is not like "the sky is blue" type information...but on the creation of proteins.
Answer by Hayden Kindell
-Yes you are misunderstanding. By information, they mean an actual code. like your height, hair color, eye color, etc. make up the qualities of your DNA. There are no two alike, and they define the unique person you are. If you were reffering to the whole thing with the dna rna and cells thing, then yes, they kind of do carry information. How? I don't know really. That would be a good question for your teacher. This probably doesn't help much... but maybe it will help....
Answer by lol rotf lmao
By inf ormation it means that in the DNA, there is "information" in their for the blue prints of proteins. The information is in DNA by means of the nucleotides A, T, G, and C which can be read by other proteins to and transcribed into mRNA which is then translated into functioning proteins. So, the nucleotides are arranged in orders that when read, transcribes, and translated, it will form a specific protein. This protein can carry a certain function, and sometimes, is there is a mutation in the nucleotide sequence, the information can be ruined and a different protein can be produced which is most of the time a bad thing. Such as the information for skin color. Melanin is a protein made in cells that makes the color of the cell be a certain color. In some races, the DNA reads to create a lot of melanin which can cause darker skin color. Without DNA there would be no proteins, and without proteins, the cell can not carry out function, and with out functioning cells, there can be no life.
Answer by Chris Vester
The basic composition of DNA nucleotide is a phosphate group, a sugar (deoxyribose) and a nitrogenous base. The Phosphate group and sugar never change in DNA however there are four different nitrogenous bases Adenine, Guanine, Thymine and Cytosine. These four nitrogenous bases compose the information that is stored in DNA. They compose the alphabet of DNA: A,G,T,C Depending on which order they are in is the "information" that is stored within DNA. RNA makes copies of the DNA which is then transported outside of the nucleus where ribosomes take amino acids and chain them into proteins depending on the information that was copied from the DNA. See for more info: http://www.ehow.com/about_4596107_what-four-nitrogenous-bases-dna.html
Answer by scottsdalehigh64
DNA carries the information needed for embryological development of an organism as well as the information needed for maintenance of the organism. The DNA is the storage medium, and the synthesis of RNA leads to the decoding of the information to produce the results. From the perspective of information theory, each nucleotide carries two bits of information.
Answer by freefalling_00
It does carry information, but I'm thinking your confusing genetic information to something like electronic information, maybe, or perhaps even word? No it does not carry binary codes or e-mails or something like that. It codes for something much more simpler, but extremely extraordinary.What DNA merely is is just strand of nucleic acid and sugars called nucleotides. There are only four kinds them in DNA, called A T C or G, and they connect in a long straight chain. Keep in mind the the letters ATCG are not actually on the DNA. What actually on it are groups of sugars, which the letter represent, connected together that Ribosomes recognize. The order in which they are in presents a code for ribosomes to translate into something useful. For example, Here's a mash of the 4 nucleotides that means something to ribosomes: GATTACAGATTACATGAACC Knowing that DNA gets translated by 3 nucleotide bases (called a codon) the ribosomes will translate this as: GAT-TAC-AGA-GAT-TAC-AGA-TGA-ACC. Each codon will then be translated again into a corresponding protein, which then interacts together to form some kind of compound. Here's an analogy that might help. Think of DNA as the blueprints of a building, the architects as ribosomes, and the pieces of wood they use are proteins being used to build one large house. This is incredibly watered-down, but thats essentially what DNA is.
Answer by emucompboy
It's encoded in the base sequence along the length of the DNA. Similarly, CDs carry information encoded in the positions of pits along tracks. DNA encodes two bits of data per base pair. With a haploid genome size of three billion base pairs, that's about 750 megabytes. So a haploid human genome would fill that CD we were just talking about.
MC Gamer Let's Plays - Wind Waker: Episode 14 - Sailing Around TownNot much to do but some silly things on our way to the Forest Haven! â² Follow MC Gamer Twitter twitter.com Facebook facebook.com Blog supermcgamer.com Website http â² General Information Currently, I create videos on my custom-built computer that has an i7 2600k processor, 16GB of RAM and a GTX 580 graphics card. I record my console gameplay using the Blackmagic Intensity Pro capture card which I later edit using Adobe Premiere Pro CS5.5. I also use Audacity and Adobe After Effects for additional post-production work. I currently use a Rode Podcaster microphone. I am an entrepreneurial geek who is running a non-profit organization in my home state of Pennsylvania. I enjoy chicken. â² Video Credits All content within is owned by their respected companies, developers and publishers. Thanks to Thanos for the Piano Arrangement of Dragon Roost Island!
Ross Franklin/Associated Press
Felix Baumgartner's space capsule at the launch site as the sun rose in Roswell, N.M. on Sunday.
ROSWELL, N.M. â" As the winds calmed Sunday morning, Felix Baumgartnerâs team made the critical decision to begin inflating an enormous helium balloon designed to carry him to the stratosphere, where he hoped to make the highest jump in history and become the first sky diver to break the speed of sound.
Once inflation began, the balloon could not be reused, and this was Mr. Baumgartnerâs only remaining balloon. The other one had been inflated on Tuesday, his first attempt, but a gust of wind twisted it and forced the launch to be canceled. Obtaining a new balloon would take five weeks, and his team said that it would arrive too late for another attempt this year because it would be too windy in November.
The inflation began at 10:45 a.m. Eastern Standard Time, with launch planned for noon.
Launching the balloon is one of the most difficult and dangerous parts of the mission. To reach the thin air at 120,000 feet â" 22 miles above the New Mexico dessert â" requires the largest balloon ever used for a manned flight. Made of 40 acres of ultrathin plastic, it has been described as an inflated dry-cleaning bag that would fill the Los Angeles Coliseum.
When inflated and attached to the Mr. Baumgartnerâs pressurized capsule, the balloon towers 750 feet above the ground. The winds at that level and at the ground must be less than three miles an hour for it to be launched safely, so that there is no chance of the balloon lurching and smashing the capsule into the ground. Once the balloon rises above 4,000 feet, Mr. Baumgartner can parachute to safety, but below that altitude there is not enough time for him to get out safely, which is why engineers call it the Dead Zone.
Mr. Baumgartner, wearing a pressurized suit to survive in the near vacuum at the edge of space, planned to step off the capsule above 120,000 feet and quickly break the sound barrier, reaching a speed of more than 700 miles an hour. He expected to free fall for five and a half minutes before deploying his parachute a mile above the ground.
Mr. Baumgartner, a professional daredevil, was backed by a NASA-style mission control operation at an airfield in Roswell that involved 300 people, including more than 70 engineers, scientists and physicians who have been working for five years on the project, called Red Bull Stratos, after the drink company that has financed it.
While building the customized suit and capsule, the team of aerospace veterans had to contend with one crucial uncertainty: What happens to the human body when it breaks the sound barrier? There was also one major unexpected problem for Mr. Baumgartner, 43, an Austrian daredevil and former paratrooper known to his fans as Fearless Felix.
Although he had no trouble jumping off buildings and bridges, and across the English Channel in a carbon-fiber wing, he found himself suffering panic attacks when forced to spend hours inside the pressurized suit and helmet. At one point in 2010, rather than take an endurance test in it, he went to the airport and fled the United States. With the help of a sports psychologist and other specialists, he learned techniques for dealing with the claustrophobia.
Besides being his most complex challenge, the stratospheric jump is also the one most likely to be made into a buddy movie, thanks to the friendship that he developed with Joe Kittinger, the retired Air Force colonel who for more than a half century held the records for the highest jump, longest free-fall and fastest speed. Mr. Kittinger, now 84, helped train Mr. Baumgartner to break his own record, and he was the voice guiding Mr. Baumgartner during the long ascent as they went through the pre-jump checklist.
Mr. Kittinger, a former test pilot, set his records in a 1960 trip to the stratosphere. Early during that ascent, also over New Mexico, in an Air Force balloon, one of his pressurized gloves leaked, but he was so determined to keep going that he did not report the problem even after his hand swelled to twice its normal size.
Ignoring the pain, he rode the balloon up to 102,800 feet and said a short prayer â" âLord, take care of me nowâ â" before stepping off. He reached a speed of 614 miles an hour and spent 4 minutes, 36 seconds in free fall. Those records were repeatedly challenged during the ensuing half century, sometimes with fatal consequences.
Besides aiming at records, the engineers and scientists on the Red Bull Stratos team are gathering and publishing reams of data intended to help pilots, astronauts and perhaps space tourists survive if they have to bail out.
âWeâre testing new spacesuits, escape concepts, and treatment protocols for pressure loss at extreme altitudes,â said the Red Bull Stratos medical director, Dr. Jonathan Clark, who formerly oversaw the health of space shuttle crews at NASA. âThere are so many things that could go wrong here that weâre pushing the technical envelope.â
The original stratospheric jump by Mr. Kittinger was part of an Air Force program studying ways to help pilots survive high-altitude bailouts. It experimented with a small parachute, called a drogue, to prevent the jumperâs body from going into a flat spin â" a hazard that almost killed Mr. Kittinger in a preliminary jump in 1959. When his drogue chute became entangled around his neck, his body spun at 120 revolutions a minute, causing him to blackout until his emergency parachute automatically deployed. An improved version of that drogue chute is now used by military pilots who have to bail out in the ejection-seats used by pilots.
Mr. Baumgartner was equipped with his own customized high-tech drogue chute, but it was there as a precaution â" to be activated only if he began spinning out of control. Otherwise, he planned to avoid using it because the drogue chute would have slowed him down just enough to prevent him from going supersonic.
To avoid spinning out of control, Mr. Baumgartner practiced doing a bunny hop out of the capsule and controlling his body so that it rotated into headfirst position for the supersonic descent.
âWe try to anticipate as much as we can about supersonic speed,â Dr. Clark said before the jump, âbut we donât really know, because nobody has done this before.â
Let's play Terraria - Ãpisode 3 - Corruption, me voila !Page Officiel Facebook : on.fb.me Twitter : twitter.com Troisième vidéo, ce sera la dernière sur cette version beta du jeu étant donné que le jeu sors aujourd'hui sur steam. J'ai mentionné que le jeu sortait aux alentour des 19 heures mais cette information est erronée, on ne sais pas encore quand le jeu sera disponible. Je compte faire un petit concours la semaine de lancement du jeu pour offrir le jeu à l'un de mes abonné choisis au hasard. Plus de détail à ce sujet dans le courant de la semaine. Abonnéez vous et aimez la vidéo si vous souhaitez apporter votre soutiens a cette chaine. Merci a tout ceux qui l'on déjà fais car ça m'aide grandement et la série deviens déjà de plus en plus connue.





0 comments:
Post a Comment